Dna replication, transcription, & translation (10 points)
1. provide the (a) dna strand and (b) mrna strand that would be produce from the
following dna template: gctaccgactcgactgcactt
a. dna strand:
b. mrna strand:
2. what enzyme(s) is adding nucleotides to the template dna strand during (a) dna replication
and (b) transcription
a. dna replication:
b. transcription:
3. use the mrna strand from question 1 to translate into a series of proteins. use the
codon chart attached and fill out the chart below.

Archeologists have discovered three sites showing conclusive evidence for the mastery of fire in tanzania, from a period slightly after the time that homo habilis was present in africa. these sites clearly were founded by homo erectus, the descendent species of homo habilis that migrated north, out of africa and into asia. homo erectus was known to have mastered fire, from ample evidence at sites in asia. there is no reason to attribute mastery of fire to homo ergaster, the descendent species of homo habilis that remained in africa.which of the following is an assumption on which the argument depends? (a) before their migration, homo erectus occupied african territory as far south as tanzania.(b) the strain of migration provided the selective pressure motivating homo erectus‘ mastery of fire.(c) homo ergaster would not have derived as much benefit from the mastery of fire as did homo erectus.(d) homo ergaster inherited all cultural knowledge from homo habilis, a species that did not have mastery of fire.(e) homo ergaster did not occupy regions as far south as tanzania until well after the time of these three sites.