Protein synthesis and mutation cer practice
what is the type of mutation that has occurred in this sequence and its
significance?
original dna sequence: ctgcacctgactcctgaggag
mutated dna sequence: ctgcacctgactcctgggag
claim:

the solute can move "downhill," from regions of higher to lower concentration, relying on the specificity of the protein carrier to pass through the membrane. this process is called passive transport or facilitated diffusion, and does not require energy.

a plastic spoon that has a temperature of 78° f is placed into a bowl of soup that has a temperature of 84° f. which of these correctly describes what will happen?

energy as heat moves from the soup to the spoon.

they have identical fossils of organisms that have evolved over time.

both have animal fossils preserved in them due to weathering and erosion.

they contain different fossils because life on earth has changed through time.

the fossils in them were formed on the surface of earth due to exposure to sunlight.