subject
Biology, 28.01.2021 22:20 natetheman7740

Select the two correct statements. Select the two correct statements. All proteins will show different degrees of divergence because different species exhibit different patterns of behavior and have different metabolic pathways. All proteins will show the same degree of divergence because all cellular functions are essential to the survival of the organism.

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 23:00
Compare the depth of field when focusing with low power and high power. which power has the greater depth of field?
Answers: 1
question
Biology, 22.06.2019 01:00
Which of the following statements is true? a. there are more chromosomes in an organism than there are genes. b. there are more genes in an organism that there are chemical bases. c. dna is made of sugar, phosphate, and carbon. d. genes are found in specific locations on a chromosome.
Answers: 1
question
Biology, 22.06.2019 07:30
Directions: read the descriptions of the four islands presented in the lesson. 1. list two new traits that each new species of rat might demonstrate as it adapts to the conditions on each island. 2. introduce one of the four new rat species to another island and describe one challenge it would encounter and one success as it adapts to its new environment.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Select the two correct statements. Select the two correct statements. All proteins will show differe...
Questions
question
Mathematics, 02.06.2020 00:00
question
History, 02.06.2020 00:00
question
Mathematics, 02.06.2020 00:00
question
Mathematics, 02.06.2020 00:01
question
Mathematics, 02.06.2020 00:01
Questions on the website: 13722360