Arts, 06.11.2020 21:30 ramirezzairap2u4lh

Sylvie has a leather cord that is 30 inches long. She needs 6 inches of leather to make a bracelet. How much leather cord will Sylvie have after she removes 6 inches?

Answers: 2

Show answers

Another question on Arts

Arts, 22.06.2019 08:00

What are the two ways in which you can identify forms? cones and spheres are examples of (dark/artifical/geometric) forms, whereas mountains and trees are (natural/organic/light) forms.

Answers: 2

Answer

Arts, 23.06.2019 04:10

Quarter note + quarter note + eighth note + sixteenth note + sixteenth note=

Answers: 1

Answer

Arts, 23.06.2019 17:00

What consists of electronic components that store instructions ready to be executed and the data needed by those instructions

Answers: 3

Answer

Arts, 24.06.2019 16:30

Monitoring your grades will you pinpoint your academic weaknesses. select the best answer from the choices provided t f

Answers: 1

Answer

You know the right answer?

Sylvie has a leather cord that is 30 inches long. She needs 6 inches of leather to make a bracelet....

Questions

Mathematics, 26.05.2020 22:01

Please help I’ve tried this many times but can’t get it

Mathematics, 26.05.2020 22:01

What is the answer ? ...

English, 26.05.2020 22:01

Answer asap thank you ...

History, 26.05.2020 22:01

7. The essay "African Migration to Colonial America" claims that the Middle Passage represents black people's "will to survive." Does Olaudah Eq...

History, 26.05.2020 22:01

World War 2 was the deadliest war in history. Which of the following is the approximate total number of deaths during the war?1. more than 100 m...

Mathematics, 26.05.2020 22:01

A football field is 360 feet long. the titanic was 883 feet. about how many football fields long was the titanic? write your answer as a whole number...

Mathematics, 26.05.2020 22:01

Evaluate f(x)=3^x +4 when x=2 A. 10 B. 13 C. 18 D. 36...

Mathematics, 26.05.2020 22:01

What is the slope of the line that passes through the points R(11, 6) and S(9, -1)?...

Mathematics, 26.05.2020 22:01

Can someone help me with this math problem. ...

History, 26.05.2020 22:01

Jesus inaugurated the Kingdom of God when he began his public ministry, but the Kingdom of God has not yet come to earth in its fullness. Thus, the Ki...

English, 26.05.2020 22:01

Why do u think Paulsen chose to use Brian third person limited point of view rather than Brian First person point of view or a third person objective...

Mathematics, 26.05.2020 22:01

I NEED HELP! Please answer this! ...

Mathematics, 26.05.2020 22:01

Find the ratio in simplest form. 2 to 4. o 1 O Tlo...

Geography, 26.05.2020 22:01

Does anyone wanna join my padlet or talk?...

Social Studies, 26.05.2020 22:01

Help please! What is an annually balanced budget IN YOUR OWN WORDS?...

Biology, 26.05.2020 22:01

Sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT...

Spanish, 26.05.2020 22:01

HELP! Will mark brainliest! ...

Mathematics, 26.05.2020 22:01

For two weeks, Gabrielle raised money by selling magazines. She raised $72 during the second week, which brought her total to $122. Write and solve an...

English, 26.05.2020 22:01

What is population and environment...

History, 26.05.2020 22:01

Which statement best describes the fourteenth amendment? A) it granted citizenship to all individuals living in the US B) it f...