subject
Biology, 18.07.2019 03:00 nshuey0930

What is skeletal connective tissue? give its function

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 13:00
The part of a desired plant inserted into rootstock during grafting is called the
Answers: 2
question
Biology, 22.06.2019 00:30
On a recent expedition to a remote region of northern canada, scientists uncovered skeletal remains from about 100,000 years ago. surprisingly, all the skeletal remains, which included many species from differing biological families and spanned about two thousand years, showed evidence of experiencing temperatures in excess of 1000 degrees fahrenheit (or 538 degrees celsius). which of the following, if true, best explains the apparent paradox between the cold environment and the evidence of the bones experiencing hot temperatures? (a) chemical changes that naturally occur during the process of decay in only one north canadian species produce the same evidence of the species' skeletons being exposed to hot temperatures as the expedition scientists found. (b) a little over 103,000 years ago, a large fire is known to have occurred in northern canada. (c) strong evidence exists that as early as 70,000 years ago, homo sapiens around the world relied heavily on fire to cook animals. (d) in the same expedition and in roughly the same layer of excavation, scientists found rudimentary wood cutting and hunting tools used by early humans.
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:00
Cells control gene expression at which steps
Answers: 1
You know the right answer?
What is skeletal connective tissue? give its function...
Questions
question
Mathematics, 12.11.2020 06:30
question
Biology, 12.11.2020 06:30
question
Mathematics, 12.11.2020 06:40
question
Mathematics, 12.11.2020 06:40
question
Biology, 12.11.2020 06:40
question
English, 12.11.2020 06:40
question
Mathematics, 12.11.2020 06:40
question
Social Studies, 12.11.2020 06:40
Questions on the website: 13722362