![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 13:00
Which of the following are energy solutions that release pollution into the air>
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 20:10
Photosynthesis converts solar energy into what type of energy?
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:30
What is used as a template during replication? a- mrna b- trna c- rrna d- dna
Answers: 1
You know the right answer?
Create a sentence explaining how amino acids form proteins....
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2020 08:01
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2020 08:01
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2020 08:01
![question](/tpl/images/cats/himiya.png)
Chemistry, 28.08.2020 08:01
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 28.08.2020 08:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2020 08:01
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2020 08:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2020 08:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2020 08:01
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2020 08:01
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2020 08:01
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2020 08:01