Answers: 1
Biology, 22.06.2019 00:00
Hurry which of these is true about index fossils? a) are very scarcely found b) used as guides in relative dating c) found in the youngest layer of the rock d) used as reference points in absolute dating
Answers: 2
Biology, 22.06.2019 08:30
Scientists discover two populations of mice on either side of a major river. the two populations have almost identical genes but the mice from one side cannot breed with mice from the other. this is most likely because
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 17:10
How would you describe an allele that be expressed and determines an organisms appearance? a.uncapitalized b.responsive c.recessive d.dominant
Answers: 1
How did lazzaro spallanzi contribute to biology?...
Mathematics, 09.03.2021 03:20
Mathematics, 09.03.2021 03:20
Biology, 09.03.2021 03:20
Mathematics, 09.03.2021 03:20
History, 09.03.2021 03:20
Social Studies, 09.03.2021 03:20
Mathematics, 09.03.2021 03:20
Mathematics, 09.03.2021 03:20