Which of these statements is not correct? which of these statements is not correct? quick freezing kills all vegetative bacterial cells. shorter-wavelength radiation is more suitable for microbial control than longer-wavelength radiation. uv radiation is useful for disinfecting surfaces. filtration can remove all bacteria and viruses from a solution if the pore size is small enough?
Answers: 1
Biology, 22.06.2019 05:20
Use this dichotomous key for insect identification to identify the insect shown. 1. a. insect has one pair of wings. order diptera b. insect has two pairs of wings. go to #2 2. a. front wings thicker in texture than hind wings go to #3. b. front and hind wings are same texture throughout. go to #4 3. a. front wings are short order dermaptera b. front wings cover entire abdomen order coleoptera 4. a. wings with scale on all parts of their area. order lepidoptera b. wings without scales go to #5. 5. a. hind wings smaller than front wings. order ephemeroptera b. front and hind wings nearly equal in size. order odonata the insect pictured is in the order diptera. ephemeroptera. coleoptera. odonata.
Answers: 3
Biology, 22.06.2019 09:00
Which of the following statements about protists are true? a.they are typically found in moist environments. b.they are all unicellular. c.they have a nucleus. d.they are all multicellular.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:30
Asegment id dna that is artificially created from two or more organism through use of dna enzymes in a laboratory is called a segment of dna that is artificially created from two or more organisms through use of dna enzymes in a laboratory is called
Answers: 1
Which of these statements is not correct? which of these statements is not correct? quick freezing...
Geography, 01.02.2020 15:42
Mathematics, 01.02.2020 15:42
English, 01.02.2020 15:42
Mathematics, 01.02.2020 15:43
Computers and Technology, 01.02.2020 15:43
Biology, 01.02.2020 15:43
Biology, 01.02.2020 15:43
Social Studies, 01.02.2020 15:43
Health, 01.02.2020 15:43
Mathematics, 01.02.2020 15:43
World Languages, 01.02.2020 15:43
History, 01.02.2020 15:43
Mathematics, 01.02.2020 15:43