Achondroplasia is caused by an autosomal dominant allele and individuals who inherit two copies of the allele do not survive to birth. what is jennifer's genotype for the gene involved in achondroplasia? what is bill's genotype for the same gene? jennifer and bill hope to have a child. what is the likelihood that they will give birth to a child with achondroplasia? what is the likelihood that they will give birth to a child without the condition?

Control of the body is accomplished by which of the following body systems? nervous system and circulatory system endocrine and repertory system circulatory and respiratory systems nervous system and endocrine systems

Cattle with brown fur and cattle with white fur will produce a reddish roan calf . when examined closely, the calf show about an even number of brown hairs and white hairs that give a reddish appearance when viewed from far away. the fact that both the brown fur allele and the white fur allele are expressed equally in the offspring is an example of

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?