5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for theme template strand above. what would the mrna be based upon the template strand above? mrna what would the primary linear structure of the protein be based upon the mrna strand above?due tonight.

When does a spring tide occur? question 9 options: they occur when the sun, moon, and earth are aligned. in spite of their name, these tides occur twice a year in the spring and fall. they occur on the date of the vernal equinox each year, no matter what stage the moon is in. this is why they are called spring tides. they occur when the sun, moon, and earth are at 45-degree angles from each other. this happens once every spring. they occur when the sun, moon, and earth are aligned. in spite of their name, these tides occur all year long.