5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for the template strand.

Hunting in the darksome fish rely on senses beyond sight. in the darkness of the marianas trench, a fish called the rattail has an extremely sensitive sense of smell. the fish uses scent, rather than sight, to steer toward food. once it's near food, the rattail uses a special organ on the bottom of its chin to guide itself by feel.marine snowone staple of the deep sea diet is "marine snow," flakes of organic, edible substances that sink down from the upper ocean. animals at the ocean's bottom find sustenance in everything from the bodies of dead creatures to fecal matter. marine snow is diverse enough to support numerous species. for instance, several species of snails and worms feed exclusively on deceased whales.microorganismsthe deep sea is an intricate ecosystem, and even the ocean floor itself plays a part. hydrothermal vents are cracks in the sea floor where erupting magma mixes with ocean water to produce plumes of hot, sulfur-rich chemicals. some microbes can use these chemicals for energy, sustaining their existence and that of the animals who depend on their roles in the deep sea food chain.

It's either -limiting factors or -scarce resources but i'd go with my first answer since the food and water are abundant they really aren't scarce