5' atgcccgggtgtcgtagttga3' complete the complementary sequence for the template strand

Which equation is used to calculate the magnetic force on a charge moving in a magnetic field

Which layer will become saturated first when rain falls?

Research cheetahs on the internet what has contributed to this animal becoming "endangered" or "threatened." what animal you have chosen? -cheetah how long has the animal been endangered or threatened? what has contributed to this animal’s endangered or threatened status? why is it important to save this animal from extinction? after researching and gathering facts, write a 350-word letter from the point of view of an animal rights' activist. be sure to include at least five facts that you learned from your research.