subject
Biology, 11.01.2020 20:31 elizabethhubbe

Biology pls,,

will give points : )


Biology pls,,will give points : )

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 00:10
Why does meiosis produce cells with half the chromosomes? o a. most of the chromosomes are not necessary to keep an organism alive. b. a gamete needs only half the number of chromosomes because two gametes join together. o c. it makes the gametes easier to move around in the organism. o d. it is faster to produce gametes with fewer chromosomes.
Answers: 1
question
Biology, 22.06.2019 04:30
Which phase of the cell cycle ensures that identical copies of the dna are made for daughter cells?
Answers: 1
question
Biology, 22.06.2019 04:30
The specific heat of ice is 0.5 calories/gramΒ°c. 20 grams of ice will require ll calories to raise the temperature 1Β°c. 05
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Biology pls,,

will give points : )
...
Questions
question
Mathematics, 13.07.2019 07:20
Questions on the website: 13722367