Biology, 07.01.2020 21:31 MoogleCaliS
Which feature of the ocean floor results when one plate is pulled under another? abyssal plain
mid-ocean ridge
trench
coastal slope
Answers: 2
Biology, 21.06.2019 22:30
~fourth largest plate ~includes parts of the indian and atlantic oceans ~subducts below the eurasian plate on the west side ~ the arabian and somali plates form boundaries with it what is the name of the tectonic plate described above? a) african plate b) eurasian plate c) north american plate d) indo- australian plate
Answers: 1
Biology, 22.06.2019 04:00
Aperson is outside exercising. body temperature begins to rise, and the person starts to sweat. their body temperature then returns to normal, and the body stops sweating. a positive b negative c allosteric d homeopathic
Answers: 1
Biology, 22.06.2019 08:30
What does polymerase chain reaction (pcr) do? o a. separates dna fragments by size o b. cuts a dna sample into fragments o c. provides an overall picture of a person's chromosomes o d. makes more copies of a sample of dna
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Which feature of the ocean floor results when one plate is pulled under another? abyssal plain
Mathematics, 17.07.2019 15:20
History, 17.07.2019 15:20
Social Studies, 17.07.2019 15:20
Social Studies, 17.07.2019 15:20
History, 17.07.2019 15:20
Biology, 17.07.2019 15:20
Social Studies, 17.07.2019 15:20
Social Studies, 17.07.2019 15:20
Business, 17.07.2019 15:20
Business, 17.07.2019 15:20
Social Studies, 17.07.2019 15:20
Mathematics, 17.07.2019 15:20
Mathematics, 17.07.2019 15:20