According to the endosymbiont hypothesis, a. most of the genes from the endocytosed bacteria moved to the nucleus b. most of the genes from the endocytosed bacteria moved to the nucleus, the host anaerobe became dependent upon the endocytosed bacteria, and the endocytosed bacteria became dependent on the host cell c. the host anaerobe became dependent upon the endocytosed bacteria d. all endocytosed bacteria were photosynthetic e. the endocytosized bacteria became dependent on the host cell

How is mitosis different in plants and animals? a. in animals, the cell membrane pinches together. b. in plants,the dna is one circular chromosomes. c. in plants, there are no sister chromatids. d. in animals, a new cell wall forms.

What abo controlling alleles could kim give her child

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?