subject
Biology, 11.11.2019 19:31 augestfaith

Which one of the following does not occur when blood passes through most systemic capillary beds? a. the ph of the blood decreases. b. the partial pressure of o2 in the blood decreases. c. the number of erythrocytes per μl of blood increases. d. water, ions and proteins diffuse from the plasma into the interstitial space. e. per unit time, the volume of blood leaving the capillary in the downstream venule is more than the volume of blood that entered the capillary from the upstream arteriole.

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 16:30
Ascientist is studying muscle twitches in chicken quadriceps. to activate the muscle, he needs to provide stimulus to the
Answers: 1
question
Biology, 22.06.2019 03:30
Cold case files recently began re-investigating an old murder case. the murder took place in the park; a young man, james, was hit over the head with a brick and killed. police suspected the jealous former boyfriend of james' wife, karen. whoever killed james may have washed their hands in a near-by bird bath as detectives found blood in the bird bath. since the murder took place before dna fingerprinting was available, the suspected killer, ronnie, went free. detectives are now reviewing the blood evidence using dna fingerprinting. based on the dna fingerprints of all possible suspects, who is james' killer?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:00
We can be sure that a mole of table sugar and a mole of vitamin c are equal in their 1) mass in daltons. 2) mass in grams. 3) number of molecules. 4) number of atoms. 5) volume.
Answers: 3
You know the right answer?
Which one of the following does not occur when blood passes through most systemic capillary beds? a...
Questions
question
Biology, 04.01.2021 17:10
question
Mathematics, 04.01.2021 17:10
question
Arts, 04.01.2021 17:10
question
Social Studies, 04.01.2021 17:10
Questions on the website: 13722361