Answers: 1
Biology, 21.06.2019 17:30
Charles darwin published his theory of evolution in 1859. in what way foes modern evolutionary theory differ from the theory as proposed by darwin? a) darwin inferred that individuals can evolve, but modern generic science has shown that this is not true. b)darwin inferred that individuals do not evolve, but modern genetic science has shown that this is not true. c)modern science has disproved most of darwin's original theory of evolution, because darwin knew nothing about generations and their role in heredity. d)generic studies have shown that gene expression and other factors operate along with natural selection, but most of darwin's theory has been supported by modern science.
Answers: 1
Biology, 22.06.2019 02:00
The idea of spontaneous generation was disproved by in a experiment involving jars of meat
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
Anormal strand of dna is shown below, followed by the same strand of dna after mutations have occurred.
Answers: 3
Tobacco mosaic virus (tmv) has been found in virtually all commercial tobacco products. why, then, i...
Mathematics, 22.09.2021 08:20
Mathematics, 22.09.2021 08:20
Mathematics, 22.09.2021 08:20
Social Studies, 22.09.2021 08:20
History, 22.09.2021 08:20
Mathematics, 22.09.2021 08:20
Mathematics, 22.09.2021 08:20
Mathematics, 22.09.2021 08:30
Mathematics, 22.09.2021 08:30