Assume that in a small population, 15 percent of the people are blue-eyed and have brown hair. assume further that within this population, there is an adventurous group that wishes to explore the region and settle down in new territory. of this adventurous group, 87 percent are blue-eyed and have brown hair. when they leave, the gene frequencies in the remaining population will change for blue-eyes and brown hair in the next generation. this is an example of

Which is an important function of normal flora? a. aid with bone marrow production. b. crowd out pathogenic bacteria. c. destroy digestive track pathogens. d. manufacture iron in the bloodstream.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Some of the money that people deposit into a bank eventually becomes a interjection into the economy when the bank