How do cells in a multicellular organism become specialized? a. genetic recombination determines which genes are located in each cell within a multicellular organism. b. each type of cell in a multicellular organism has slightly different dna, allowing the different types of cells to specialize. c. the genes necessary for different types of cells to function segregate into different cell types in a multicellular organism. d. gene expression is regulated so that different genes are turned off and on at specific times during development of a multicellular organism.

Use the drop-down menu to complete the statement. an electron in the first energy level of the electron cloud has an electron in the third energy level.a. a lower energy thanb. a higher energy thanc. the same energy as

Which worm has eyespots that are used to detect light? a fluke b marine worm c planarian d tapeworm

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?