Acell biologist isolates a protein-rna complex that exhibits catalytic activity. treatment of this complex with rnase completely abolishes catalytic activity. however, treatment of the complex with proteases results in only a 15% decrease in catalytic activity. which of the following is the most likely explanation for these data? 1) the catalytic activity of the complex is completely dependent on the protein component and only enhanced by the rna component of the complex. 2) the catalytic activity of the complex is enhanced by the protein component and enhanced by the rna component of the complex. 3) the catalytic activity of the complex is enhanced by the protein component and completely dependent on the rna component of the complex. 4) the catalytic activity of the complex is independent of the protein component and only enhanced by the rna component of the complex.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?