![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:30
Mention true or false : a) cholera is marked by acute diarrhea and no urination. b)mosquitoes are the source of dysentery germs.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 20:00
Read the following scenario to answer the following question. over the past 60 years, many amphibian species have experienced significant population declines, and some species have become extinct. scientists suspected that local human activities such as the destruction of wetlands, regional pollution, and deforestation were the main reasons for these losses. however, research over the past 20 years reveals significant amphibian population declines in protected areas of the world, such as nature preserves and parks. these global declines suggest widespread problems including increased ultraviolet radiation, acid rain, and disease. in switzerland, for example, 14 of the 20 native amphibian species are threatened with extinction. when most populations of a wide-ranging amphibian species are lost and the few remaining populations are widely separated, we expect to see that a. the founder effect becomes increasingly important b. microevolution no longer occurs c. gene flow between populations is reduced d. artificial selection becomes a greater factor in microevolution
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:40
Which of the following factors would not contribute to allopatric speciation? a) a population becomes geographically isolated from the parent population.b) the separated population is small, and genetic drift occurs.c) the isolated population is exposed to different selection pressures than the ancestral population.d) different mutations begin to distinguish the gene pools of the separated populations.e) gene flow between the two populations is extensive.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which is the strantzge of water's heat capacity?
oa
protects aquatic life from changes...
oa
protects aquatic life from changes...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.02.2021 19:30
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.02.2021 19:30
![question](/tpl/images/cats/mat.png)
Mathematics, 12.02.2021 19:30
![question](/tpl/images/cats/himiya.png)
Chemistry, 12.02.2021 19:30
![question](/tpl/images/cats/en.png)
English, 12.02.2021 19:30
![question](/tpl/images/cats/istoriya.png)
History, 12.02.2021 19:30
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 12.02.2021 19:30
![question](/tpl/images/cats/biologiya.png)
Biology, 12.02.2021 19:30
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.02.2021 19:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.02.2021 19:30
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
English, 12.02.2021 19:30
![question](/tpl/images/cats/en.png)
English, 12.02.2021 19:30
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.02.2021 19:30