Consider the following mrna strand: ccauggcaaaggagugacuaa
a. what dna sequence would encode...
Consider the following mrna strand: ccauggcaaaggagugacuaa
a. what dna sequence would encode for this mrna? provide the sequence in form (single-or doublestranded) in which it would predominantly appear in the cell. label the termini.
b. draw the result of translation in atomic detail (i. e. chemical structure).
c. how many different mrna sequences could directly* encode for this same translational product? (* disregard non-coding nucleotides.)
d. how many different single nucleotide mutations could be introduced into the directly encoding dna?
e. how many different translational products would result?
Answers: 1
Biology, 21.06.2019 21:00
This is the diveristy of ecosystems natural communites and habits it is the variety of ways that species interact with each other and their environment
Answers: 1
Biology, 22.06.2019 04:00
As studied this week in the cell cycle, we saw how a cell moves through its life with a plan. as you transition from a student at uma to a valued member of your chosen career field, what will you put into place in your life to manage and to fit the new responsibilities of your career into your current life?
Answers: 2
Biology, 22.06.2019 08:30
Which macromolecule catalyzes chemical reactions this be considered enzyme chemical reactions thus he considering enzymes
Answers: 3
Mathematics, 17.11.2020 05:50
English, 17.11.2020 05:50
Mathematics, 17.11.2020 05:50
Health, 17.11.2020 05:50
Biology, 17.11.2020 05:50
Mathematics, 17.11.2020 05:50
Mathematics, 17.11.2020 05:50
Biology, 17.11.2020 05:50
English, 17.11.2020 05:50
Mathematics, 17.11.2020 05:50