Can some one code this dna
when a cell copies its dna (replication), the original dna lad...
Can some one code this dna
when a cell copies its dna (replication), the original dna ladder is broken apart and new nucleotides me
added to the center. this creates two exact copies, each one made from half the original dna molecule,
dna polymerase (the enzyme which builds dna) will only attach twee which match with the
oniginal strand of dna
in dna replication, ademine and thymime will bong together and cytorine and granine will
bond together.
whea creating the matching stand the following pairing rules must be rand
a? t
c? g
directions. use the base pairing rules above to figure out the sequence of the new stund of dna for the
original strands below.
1.
2.
3.
4. ttaaacgagctgctagctag
Answers: 1
Biology, 22.06.2019 04:00
What is the name of the type of cell division that occurs in the prokaryotic cell cycle
Answers: 2
Biology, 22.06.2019 10:30
Jason, a dog breeder, decides to mate a poodle with a golden labrador retriever. he wants to get puppies with the curly hair of the poodle and the color of the labrador. what concept is shown in this example? question 6 options: artificial selection adaptation evolution natural selection
Answers: 1
Biology, 22.06.2019 14:00
The more rapidly sedimentation occurs, the more likely it is that the remains will successfully form a fossil. as sedimentation continues, what happens to the amount of weight settling onto the organism? stays the same increases decreases cuts in half
Answers: 2
Mathematics, 21.02.2021 20:30
Chemistry, 21.02.2021 20:30
Social Studies, 21.02.2021 20:30
SAT, 21.02.2021 20:30
English, 21.02.2021 20:30
Biology, 21.02.2021 20:30
Mathematics, 21.02.2021 20:30
Mathematics, 21.02.2021 20:30
Mathematics, 21.02.2021 20:30
Biology, 21.02.2021 20:30
Physics, 21.02.2021 20:30
Mathematics, 21.02.2021 20:30
Mathematics, 21.02.2021 20:30