Can some one code this dna

when a cell copies its dna (replication), the original dna ladder is broken apart and new nucleotides me
added to the center. this creates two exact copies, each one made from half the original dna molecule,
dna polymerase (the enzyme which builds dna) will only attach twee which match with the
oniginal strand of dna
in dna replication, ademine and thymime will bong together and cytorine and granine will
bond together.
whea creating the matching stand the following pairing rules must be rand
a? t
c? g
directions. use the base pairing rules above to figure out the sequence of the new stund of dna for the
original strands below.
1.
2.
3.
4. ttaaacgagctgctagctag