The principle of dominance is a inheritance pattern.
it’s states traits that are mask the traits that

Taq polymerase is an enzyme isolated from the organism thermophilus aquaticus. this organism has been found living in the hot springs of yellowstone national park. this enzyme is used to copy human dna from crime scenes. most reactions are performed at ranges similar to those of the human body; however, what considerations should be made for optimum use of this enzyme? view available hint(s)taq polymerase is an enzyme isolated from the organism thermophilus aquaticus. this organism has been found living in the hot springs of yellowstone national park. this enzyme is used to copy human dna from crime scenes. most reactions are performed at ranges similar to those of the human body; however, what considerations should be made for optimum use of this enzyme? the enzyme will not work on human dna.nothing should be altered.the ph should be decreased.the temperature should be raised.

Vaccines are weakened forms of disease causing microorganisms, which are given to patients to prevent disease. after the vaccine is administered, the immune system responds by creating a(n) to recognize the a.) antibody, antibiotic b.) antigen, antibody c.)antibiotic, antibody d.)antibody, antigen

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?