![subject](/tpl/images/cats/biologiya.png)
Biology, 26.11.2019 05:31 carlosbs71
You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-generated trace of the intensity of each color's fluorescence). in this figure, a = green, c = purple, g = black, t = red. the height of the peaks is unimportant. the 5' end of the sequence is at the left of the trace.
what is the sequence of the template dna used for this sequencing reaction?
a.
5' tttgctttgtgagcggataacaa 3'
b.
3' tttgctttgtgagcggataacaa 5'
c.
5' aaacgaaacactcgcctattgtt 3'
d.
5’ ttgttatccgctcacaaagcaaa 3’
e.
3' aaacgaaacactcgcctattgtt 5'
can someone with this? i can never get more than 3/5 right:
match the following terms with their descriptions below.
question selected match
used to detect close or exact complementarity to a probe sequence
c.
high stringency
used in identifying a specific mrna from a mixture
a.
northern blot
used to quantitate the initial template concentration of an unknown relative to a standard template of known concentration
b.
template dna
reliant upon dna mismatch repair
d.
site-directed mutagenesis
refers to the sequence of interest within the sample in a pcr reaction
e.
cycle threshold method (ct)
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:30
What is the "great pacific garbage patch"? a large area of marine debris concentrated by rotating ocean currents a large area around the pacific rim where debris collects from natural disasters such as tsunamis an area in the pacific ocean where trash is intentionally dumped due to lack of landfill availability a large trash dump located in hawaii
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:30
Two critical interventions to turn around the opioid crises are:
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:30
Paint and solvents pose no potential hazard to human health. select the best answer from the choices provided t f
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:00
What do you need to use in order to work as an environmental scientist? you need to use the scientific method and__ in order to work as an environmental scientist.
Answers: 1
You know the right answer?
You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-g...
Questions
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 18.12.2020 07:20
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.12.2020 07:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 18.12.2020 07:20
![question](/tpl/images/cats/mat.png)
Mathematics, 18.12.2020 07:20
![question](/tpl/images/cats/en.png)
English, 18.12.2020 07:20
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.12.2020 07:30
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.12.2020 07:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.12.2020 07:30
![question](/tpl/images/cats/mat.png)
Mathematics, 18.12.2020 07:30