What happens when an aerobic organism is placed in an anaerobic environment?
question 16 opti...
Biology, 09.12.2019 22:31 dazesreplayy7580
What happens when an aerobic organism is placed in an anaerobic environment?
question 16 options:
glycolysis stops, stopping the citric acid cycle.
the electron transport chain stops, stopping the citric acid cycle.
the citric acid cycle stops, stopping the electron transport chain.
the citric acid cycle stops, stopping glycolysis.
Answers: 1
Biology, 22.06.2019 10:00
Nephrons, the functional unit of kidneys, are responsible for formation of urine. the sentences describe situations that are the result of problems in the urine formation process. for the nephron shown below, match each situation to the step in the urine formation process where the problem lies.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 19:30
Which of the following statements is true regarding a basic amino acid? a.) the hydrophilic r group of a basic amino acid will be located on the interior of a protein b.) the positively charged r group of a basic amino acid could bind dna c.) the r group of a basic amino acid would only be able to form covalent bonds with other molecules d.) a basic amino acid would be considered both polar and hydrophobic e.) all of the above
Answers: 1
Physics, 24.08.2020 17:01
Mathematics, 24.08.2020 17:01
Mathematics, 24.08.2020 17:01
Chemistry, 24.08.2020 17:01
Social Studies, 24.08.2020 17:01
Mathematics, 24.08.2020 17:01
Health, 24.08.2020 17:01
Chemistry, 24.08.2020 17:01
Health, 24.08.2020 17:01
Chemistry, 24.08.2020 17:01
Computers and Technology, 24.08.2020 17:01
Computers and Technology, 24.08.2020 17:01
Mathematics, 24.08.2020 17:01
Mathematics, 24.08.2020 17:01