subject
Biology, 09.12.2019 22:31 dazesreplayy7580

What happens when an aerobic organism is placed in an anaerobic environment?
question 16 options:

glycolysis stops, stopping the citric acid cycle.

the electron transport chain stops, stopping the citric acid cycle.

the citric acid cycle stops, stopping the electron transport chain.

the citric acid cycle stops, stopping glycolysis.

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 10:00
Nephrons, the functional unit of kidneys, are responsible for formation of urine. the sentences describe situations that are the result of problems in the urine formation process. for the nephron shown below, match each situation to the step in the urine formation process where the problem lies.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 17:00
Which of the following do all living things have in common
Answers: 2
question
Biology, 22.06.2019 19:30
Which of the following statements is true regarding a basic amino acid? a.) the hydrophilic r group of a basic amino acid will be located on the interior of a protein b.) the positively charged r group of a basic amino acid could bind dna c.) the r group of a basic amino acid would only be able to form covalent bonds with other molecules d.) a basic amino acid would be considered both polar and hydrophobic e.) all of the above
Answers: 1
You know the right answer?
What happens when an aerobic organism is placed in an anaerobic environment?
question 16 opti...
Questions
question
Physics, 24.08.2020 17:01
question
Mathematics, 24.08.2020 17:01
question
Mathematics, 24.08.2020 17:01
question
Chemistry, 24.08.2020 17:01
question
Health, 24.08.2020 17:01
question
Computers and Technology, 24.08.2020 17:01
question
Computers and Technology, 24.08.2020 17:01
Questions on the website: 13722360