Ahomozygous recessive mom is crossed with a homozygous dominant dad. what is the probability that the offspring will have a recessive trait? what percentage of the offspring will be homozygous?
(there are no choice answers it's a written response. .)

When organisms convert from of energy, what usually results

Arrange the following in the correct sequence, from earliest to most recent, in which these plant traits originated. 1. sporophyte dominance, gametophyte independence 2. sporophyte dominance, gametophyte dependence 3. gametophyte dominance, sporophyte dependence a) 1 → 2 → 3 b) 2 → 3 → 1 c) 2 → 1 → 3 d) 3 → 2 → 1 e) 3 → 1 → 2

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?