Biology, 14.01.2020 00:31 naomi12360
Which substances are found on cell surfaces and respond to nerve and hormone signals?
Answers: 3
Biology, 21.06.2019 21:20
How is mitosis different in plants and animals? a. in animals, the cell membrane pinches together. b. in plants,the dna is one circular chromosomes. c. in plants, there are no sister chromatids. d. in animals, a new cell wall forms.
Answers: 2
Biology, 21.06.2019 22:30
Witch type of microscope is used to view very small cell components like proteins and dna?
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Which substances are found on cell surfaces and respond to nerve and hormone signals?...
Mathematics, 21.02.2020 03:50
Computers and Technology, 21.02.2020 03:51
History, 21.02.2020 03:51
Spanish, 21.02.2020 03:51
Social Studies, 21.02.2020 03:51