Biology, 16.01.2020 00:31 ginalopez567

Which of the following macromolecules surround and protect internal
organs?

Answers: 1

Show answers

Another question on Biology

Biology, 22.06.2019 04:40

Awoman whose sister tested positive for a specific mutation in the brca1 gene, which increases the risk for breast and ovarian cancer, is found not to have that mutation but does have a mutation of unknown significance near the known mutation site. how should this woman be counseled? select one: a. she should be informed that her risk for breast cancer is greater than the general population but not as great as her sister’s risk. b. she should be informed that because she does not have the mutation, her risk for breast cancer is not greater than that of the general population. c. she should be informed of her gene mutation status and be presented with all the available prophylaxis options and reconstruction options. d. she should be informed that she does not have the specific mutation but that because another mutation is present she should be vigilant about screening

Answers: 1

Answer

Biology, 22.06.2019 06:00

Onsider the paragraph above. what is one chemical property of water? a) water is a polar molecule. b) water is the universal solvent. c) water reacts with group 1 metals. d) water has a high specific heat capacity.

Answers: 1

Answer

Biology, 22.06.2019 10:10

Fruit bats in central america eat bananas and other fruits. banana plants rely on bats for pollination. what would be the most likely consequence on the banana crop if fruit bats were eliminated from the area? the banana crop would increase because bats would stop eating the crops. the banana crop would decrease because bats would no longer pollinate the crops. the banana crop would remain constant because bees would replace the bats. the banana crop would remain constant because the plants would adapt using asexual reproduction.

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?