subject
Biology, 22.01.2020 18:31 musfirahkhurram

To which skeletal system do the carpals belongs

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 22:00
Fan egg cell containing the (n+1) number of chromosomes combines with a sperm cell containing the (n) number of chromosomes, what is the result of this union? a) all future somatic cells of the organism will contain the (2n + 1) number of chromosomes. b) all future somatic cells of the organism will contain the (2n - 1) number of chromosomes. c) only certain somatic cells of the organism will contain the (2n + 1) number of chromosomes. d) all future somatic cells of the organism will contain the normal diploid number of chromosomes.
Answers: 2
question
Biology, 22.06.2019 02:10
Control of the body is accomplished by which of the following body systems? nervous system and circulatory system endocrine and repertory system circulatory and respiratory systems nervous system and endocrine systems
Answers: 2
question
Biology, 22.06.2019 07:00
What was the purpose of mendel's experiments with dihybrid crosses? a. to determine if dna was a transforming factor b. to determine if traits could be recessive c. to determine if traits affected each other d. to determine if traits had more than one allele
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
To which skeletal system do the carpals belongs...
Questions
question
Mathematics, 03.07.2020 14:01
Questions on the website: 13722361