PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation i...
Biology, 10.02.2020 02:05 ykpwincess
PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine the DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Be sure to answer this question in paragraph form using complete sentences.
Answers: 1
Biology, 21.06.2019 15:00
Which class of molecules contains the amino group, nh2 (a) sugars (b) water (c) proteins (d) hydrocarbons
Answers: 1
Biology, 22.06.2019 01:00
Which of the following is an example of competition that could be found in a forest? question 14 options: deer eat berries and their droppings seed new areas creating more berry bushes two fox populations utilize the same rabbit population as their main food source two hawk populations utilize the same scorpion population as their main food source lack of sunlight due to changes in the seasons restricts the growth of certain plants
Answers: 1
Biology, 22.06.2019 03:30
Students in biology are studying the macromolecules of life. they used a calorimeter to determine the calories in various types of food. once the lab was completed, the students ate the left over food samples. monica commented that in just 6 or 7 "chews" of the saltine, it was gone; nothing but a sticky paste in her mouth. elaborate on what happened chemically while chewing the saltine. include the macromolecules present.
Answers: 1
Biology, 22.06.2019 07:30
Which locations on the map are low-pressure areas? a b c d e
Answers: 1
Mathematics, 08.09.2021 06:50
Mathematics, 08.09.2021 06:50
Mathematics, 08.09.2021 06:50
Mathematics, 08.09.2021 06:50
Mathematics, 08.09.2021 06:50
Mathematics, 08.09.2021 06:50
Biology, 08.09.2021 06:50
English, 08.09.2021 06:50
Mathematics, 08.09.2021 06:50
Mathematics, 08.09.2021 06:50
Mathematics, 08.09.2021 06:50
Mathematics, 08.09.2021 06:50
Mathematics, 08.09.2021 06:50