Answers: 3
Biology, 21.06.2019 21:20
Indicate whether the following statements about the biases in the fossil record are true or false. a) inland species are more likely to be preserved than marine species b) organisms with hard body parts are more likely to be preserved than are those composed soft tissues. c) species that existed over a larger area are more likely to be preserved than species existing over a smaller area. d) organisms that lived very long ago are more likely to be found as fossils than organisms that lived relatively recently e) the fossils of larger organisms are more likely to be found than the fossils of smaller organisms
Answers: 2
Biology, 22.06.2019 03:30
The human genome project is devoted to mapping the general dna sequence of our species. this could lead to the development of new medicines, as well as the possibility of using gene therapy to treat certain diseases. however, there are some ethical issues surrounding the mapping of individual genomes. one concern is a) that your genes may change over time, making the project useless. b) that insurance companies could discriminate based on genetic make-up. c) that since this has never been done before, we should probably not do it now. d) that sequencing our individual genomes is so expensive, it is a counter-productive strategy.
Answers: 1
Biology, 22.06.2019 04:30
Rachel ate a piece of fruit and happened to drop the seeds in her backyard. after a few weeks, she saw a small plant with flowers growing in the backyard. which group does this plant belong to? a. angiosperms b. gymnosperms c. pteridophytes d. bryophytes e. chytrids
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Where would you most likely find an integral membrane protein?...
Mathematics, 04.12.2020 21:30
Arts, 04.12.2020 21:30
History, 04.12.2020 21:30
Biology, 04.12.2020 21:30
Mathematics, 04.12.2020 21:30
Mathematics, 04.12.2020 21:30
History, 04.12.2020 21:30
Mathematics, 04.12.2020 21:30
Mathematics, 04.12.2020 21:30
English, 04.12.2020 21:30
History, 04.12.2020 21:30
Health, 04.12.2020 21:30
Arts, 04.12.2020 21:30
Chemistry, 04.12.2020 21:30
Business, 04.12.2020 21:30