subject
Biology, 05.03.2020 08:20 mello812

What function do both cilia and flagella serve for protists?

- Reproduction
- Movement
- Getting food
- Respiration

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 17:00
Which of the following is true of photosynthesis? a)carbon dioxide is a reactant b)water is a product c)most reactions within this process are exothermic d)oxygen is a reactant
Answers: 2
question
Biology, 22.06.2019 09:30
Which short-term environmental change is most likely to lead to ground shifting, landslides, and the collapse of buildings or roads? forest fires flooding earthquakes
Answers: 1
question
Biology, 22.06.2019 10:30
In order to study genetic mutations, scientists must study genetic material. which statement describes the genetic material scientists are most likely studying? a) they study alleles that contain chromosomes, which are rna.b) they study alleles that contain genes, which are chromosomes.c) they study chromosomes that contain genes, which are dna segments.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What function do both cilia and flagella serve for protists?

- Reproduction
- Mov...
Questions
question
Mathematics, 27.07.2019 03:30
Questions on the website: 13722363