CAN SOMEBOdy explain this to me PLEASE!!

When transcribing DNA into RNA, you just flip the letters to the opposites.  But because Thymine isn't in RNA, you convert all the A's in the sequence into U, and all the T's into A.  

I didn't do your problem, but here:

Ex: ATTAGCTATCGTCGATAGGG

Step 1: break the sequence into codons, or 3 at a time.

ATT   AGC  TAT  CGC  CCC  TCG  ATA  GGG

Step 2: Convert the codons to get your transcription of RNA.

UAA UCG  AUA  GCG  GGG  AGC  UAU  CCC

Step 3: look at you chart, and in the order the new codons go in to get your genetic message.

Step 4: You're done!

Step 5: Congratulations, you learned something.

Explanation:

hope this helped

regulation of gene expression. gene expression can be regulated by various cellular processes with the aim to control the amount and nature of the expressed genes. these regulatory proteins bind to dna and send signals that indirectly control the rate of gene expression

explanation:

4.) metal

"-the movement of carbon from the nonliving environment into living things and back to the environment

-carbon is the essential component of proteins, fats, and carbohydrates (which make up all organisms)

-carbon exists in air, water, and living organisms

-producers convert carbon dioxide in the atmosphere into carbohydrates during photosynthesis

-bacteria in the atmosphere cycles through the system in filtration units

-in cellular respiration, carbon is released back into the atmosphere as carbon dioxide

-some carbon is stored in limestone (forming one of the largest "carbon sinks" on earth)

-largest carbon reservoir on earth= limestone

-carbon stored in the bodies of organisms as fat, oils, or other molecules may be released into the soil or air when the organism dies

-this may form deposits of coal, oil, or natural gas (fossil fuels, which increased the atmospheric carbon dioxide)

-fossil fuels store carbon left over from bodies of organisms that died millions of years ago

-they are located in the surface of earth, deep within the earth and beneath the ocean floor."