Biology, 10.03.2020 08:08 OrionGaming
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
Answers: 3
Biology, 22.06.2019 03:30
Rease is an enzyme used by plants to break down urea (a nitrogen-containing compound) into carbon dioxide and ammonia. urease urea > > > carbon dioxide and ammonia ammonia is broken down by plants into a nitrogen source plants need to grow. thus, plants could not use urea as a nitrogen source unless it was first converted to ammonia. in soybean plants there are two different kinds of urease, one produced in the seeds and the other produced in the leaves of the plant. three types of soybean plants were used in a set of experiments: normal soybeans and two mutant strains, one lacking the urease in the seeds only (strain 1) and one lacking urease in the leaves only (strain 2). experiment 1 separate areas in a field were planted with normal, strain 1, and strain 2 soybeans. all types of soybeans appeared to grow, flower, and produce seeds equally well. there were no externally detectable differences among the strains. experiment 2 small pieces of plant leaves of equal weight were obtained from each type of soybean plant and separately placed on media in culture dishes. tissue growing in this way will become an unorganized clump of cells referred to as callus. to provide a controlled nitrogen source, half the tissue samples of each type were placed on media containing urea, and the other half of the samples were placed on media containing ammonia. after 30 days, the weight gain for each of the callus samples was determined. results are shown in the table below.
Answers: 2
Biology, 22.06.2019 10:30
Explain what a zygote is. use the terms egg cell, sperm cell, and fertilization in your explanation.
Answers: 1
Biology, 22.06.2019 17:00
Which of the following terms would bb represent in an organism? a.phenotype b.genotype c.genetics
Answers: 2
Biology, 22.06.2019 20:30
Can result as a complication of diabetes due to damage to the arterial walls and excess fat in the blood.
Answers: 1
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequ...
Mathematics, 30.10.2020 01:00
Mathematics, 30.10.2020 01:00
History, 30.10.2020 01:00
Mathematics, 30.10.2020 01:00
Mathematics, 30.10.2020 01:00
Mathematics, 30.10.2020 01:00
Mathematics, 30.10.2020 01:00
Mathematics, 30.10.2020 01:00
Spanish, 30.10.2020 01:00
Mathematics, 30.10.2020 01:00