subject
Biology, 12.03.2020 06:44 zacklofton6518

1. Is the water in the smaller bowl dirty? Why or why not?

2. What happened to the water in the larger bowl?

3. How did the water get into the smaller bowl? Briefly explain the process.

4. This project simulates a real world process. What does the plastic wrap represent? What does the water in the cup represent?

5. Which two parts of the water cycle are at work?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 15:00
Efficiency is the percent of work put into a machine by the user (input work) that becomes work done by the machine (output work)
Answers: 1
question
Biology, 22.06.2019 04:30
Which of the following best describes the relationship between glucose and complex molecules such as hormones?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:40
Dna replication occurs in preparation for
Answers: 1
You know the right answer?
1. Is the water in the smaller bowl dirty? Why or why not?

2. What happened to the water...
Questions
question
Physics, 26.08.2019 07:50
question
Mathematics, 26.08.2019 07:50
question
Mathematics, 26.08.2019 07:50
Questions on the website: 13722363