5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. A. Both of these genes are transcribed by  70, whose "best consensus" binding site is in your Lecture 14 slides. Each promoter’s -35 site is indicated with a box. Copy-paste the sequence to your answer paper. Find and put a red/blue box around each promoter’s -10 sequence. Which is the "poorer" promoter – the red or the blue? What are two consequences of a gene having a poor promoter?

All living organisms are composed of a. only one cell. b. at least 100 cells. c. at least three cells. d. one or more cells.

1) strawberry plants typically reproduce by making runners, which are miniature versions of themselves, that grow off of the roots and stems of the parent. this type of vegetative reproduction is known as a) pollination. b) fragmentation. c) binary fission. d) vegetative propogation.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?