Biology, 17.03.2020 01:18 kraigstlistt
Given that the sequence of nucleotides in a DNA strand will be used to produce an mRNA strand that will then code for a protein, mutations in the DNA can affect the final product. Depending on the severity of the mutation, the protein can range from not being affected to being rendered completely nonfunctional, especially if the reading frame is altered. Which of the following represents a change in reading frame if the template strand of DNA reads as follows?
A) AGCTGGACTTTAGACAAG
B) AGCTGGACTTTAGACAAG
C) AGCTGGACTTGAGTGAACAAG
D) AGCTGGACTATAGACAAG
E) AGCUGGACUUUAGACAAG
F) AGCTGCGACTTTAGACAAG
Answers: 1
Biology, 22.06.2019 03:00
When mendel crossed a true-breeding short plant with a true-breeding tall plant all the offspring were tall. which term describes the gene for tallnes?
Answers: 1
Biology, 22.06.2019 06:30
Areal dna molecule consists of thousands of these pairs of nucleotides. what is the pairing arrangement of the nitrogen bases
Answers: 1
Biology, 22.06.2019 08:00
Which feature of a human community is similar to a niche in a biological community
Answers: 2
Biology, 22.06.2019 17:00
Earthquakes a.created the rock in arches utah b.can be caused by volcanic eruptions c.are caused by tsunami waves d.wear mountains down into hills
Answers: 1
Given that the sequence of nucleotides in a DNA strand will be used to produce an mRNA strand that w...
Mathematics, 05.02.2021 17:30
Mathematics, 05.02.2021 17:30
Physics, 05.02.2021 17:30
Mathematics, 05.02.2021 17:30
Mathematics, 05.02.2021 17:30
Mathematics, 05.02.2021 17:30
Mathematics, 05.02.2021 17:30
Social Studies, 05.02.2021 17:30
Mathematics, 05.02.2021 17:30