subject
Biology, 18.03.2020 18:23 Pitts1971

Write a peom comparing a single celled parameciam and a multi-celluar sunfish living in the same freshwater pond. explore ways in which organism is adapted for survial

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 05:10
1) what three conditions must be present for minerals to form through natural processes? 2) why are minerals considered inorganic substances? 3) how do oxides differ from other minerals that contain oxygen atoms? 4) how is a sulfide different from a sulfate? what makes native elements unique?
Answers: 2
question
Biology, 22.06.2019 06:30
How do living things obtain phosphorus
Answers: 1
question
Biology, 22.06.2019 08:10
In sweet pea, gene c is responsible for color production and gene p is responsible for the purple color pigment. both of them are located on two different loci on different chromosomes. the flowers will be purple only when the plant has the genotypes as c_p_. no color will be produced with genotypes: ccpp, ccpp, ccpp, ccpp. thus, gene c controls the expression of gene p. what pattern of inheritance is exhibited here? a. pleiotropy b. epistasis c. multiple alleles
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Write a peom comparing a single celled parameciam and a multi-celluar sunfish living in the same fre...
Questions
question
Biology, 22.05.2020 00:02
question
Mathematics, 22.05.2020 00:02
Questions on the website: 13722363