Biology, 23.03.2020 18:18 kdcloyd3362
Item 4 How can humans increase the rate of endangered or extinct species? pass more laws about land use
introduce new predators to an environment
reduce environmental impacts
build and populate more zoos
Answers: 3
Biology, 22.06.2019 02:00
What is an endocrine function? (apex) a.esophageal glands release mucus into the esophagus b.salivary glands release saliva into mouth c.swear glands release sweat to the skin d.the pineal gland releases melatonin into the bloodstream
Answers: 1
Biology, 22.06.2019 07:30
In which of the following relationships is one organism always benefited while the other organism is always harmed
Answers: 1
Biology, 22.06.2019 11:00
Which of these is true of the cytoplasm of an unfertilized egg? a. it is an unevenly distributed mixture of mrna, proteins, organelles, and other substances. b. it does not contain substances that are important in directing development. c. these substances are supplied by the sperm. d. it does not contain substances that are important in directing development. e. development is directed solely by the surrounding cells. f. it is a homogeneous mixture of mrna, proteins, organelles, and other substances. g. it does not contain substances that are important in directing development. h. these substances are produced by the dna of the fertilized zygote.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Item 4 How can humans increase the rate of endangered or extinct species? pass more laws about land...
Mathematics, 19.05.2020 15:23
Social Studies, 19.05.2020 15:23
Mathematics, 19.05.2020 15:23
Mathematics, 19.05.2020 15:23
Mathematics, 19.05.2020 15:23
History, 19.05.2020 15:23
Chemistry, 19.05.2020 15:23
History, 19.05.2020 15:23
Geography, 19.05.2020 15:23
Mathematics, 19.05.2020 15:23
Computers and Technology, 19.05.2020 15:23
Mathematics, 19.05.2020 15:23