Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

Chinese privet is a plant that is native to china. over 150 years ago, chinese privet was introduced to the united states as a fast-growing shrub that serves as an excellent privacy hedge. with no natural herbivore, chinese privet quickly established itself and spread in natural areas throughout the southeast and eastern seaboard of the united states. its dominance in these areas has jeopardized the survival of native plant species. chinese privet provides evidence that introducing non-native organisms can cause environmental damage integrated pest management strategies will not decrease chinese privet populations american gardeners can easily control the spread of chinese privet non-native plant species have type i survivorship curves

List charasteristics of athenosphere

Veins have a much lower blood pressure than arteries. which of these prevents backflow of blood in veins? a. pressure applied by the heart b. one–way valves in veins c. thin muscular walls of veins