Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?
a. Normal gene: ATGGCCGGCCCGAAAGAGACC
b. Mutated gene: ATGGCCGGCACCGAAAGAGACC
c. Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
d. Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
Answers: 1
Biology, 22.06.2019 00:00
Read the sentence. “yesterday we arrived late for the outdoor concert in the city gardens.” which words in the sentence are adverbs? a. late; city b. yesterday; outdoor c. yesterday; late d. outdoor; city
Answers: 1
Biology, 22.06.2019 03:20
Which of the following statements most accurately describes convergent evolution? the process in which two similar species evolve separately from each other and share similar characteristics the process in which a single species evolves into two or more new species the process in which two entirely different species evolve in response to each other the process in which two different species evolve separately from each other but still share similar characteristics
Answers: 3
Biology, 22.06.2019 19:30
How does the fermentation of pyruvic acid in cells contribute to the formation of atp? a. it completes the oxidation of glucose to co2, creating atp. b. it generates lactic acid, which cycles back through the krebs cycle, producing 2 atp molecules. c. it converts fadh2 to phosphate, which bonds with adp. d. it produces 2 nad+ molecules, which cycle back to fuel the glycolysis reaction, allowing 2 atp molecules to be produced.
Answers: 1
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is...
Mathematics, 03.12.2020 15:40
Mathematics, 03.12.2020 15:40
English, 03.12.2020 15:40
Social Studies, 03.12.2020 15:40
Social Studies, 03.12.2020 15:40
English, 03.12.2020 15:40
Mathematics, 03.12.2020 15:40
Physics, 03.12.2020 15:40
Mathematics, 03.12.2020 15:40
Biology, 03.12.2020 15:40
English, 03.12.2020 15:40