A tall pea plant (Tt) is crossbred with a short pea plant (tt). The following Punnett square shows the separated alleles for two pea plants.

Which of the following shows the correct match of the box numbers and the genotype of the offspring?

1 = Tt; 2 = tt; 3 = Tt; 4 = tt
1 = Tt; 2 = Tt; 3 = Tt; 4 = Tt
1 = Tt; 2 = Tt; 3 = tt; 4 = tt
1 = Tt; 2 = tt; 3 = tt; 4 = tt

Why reason best illustrates why hershey and chase chose to use viruses in their experiment?

What was the purpose of mendel's experiments with dihybrid crosses? a. to determine if dna was a transforming factor b. to determine if traits could be recessive c. to determine if traits affected each other d. to determine if traits had more than one allele

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?