subject
Biology, 04.04.2020 08:03 ashl3yisbored

Question:

How do transgenic animals contribute to human welfare? Include one agricultural application and one health related application.

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 04:40
The negative impacts of nonnative species generally outweigh the positive impacts
Answers: 1
question
Biology, 22.06.2019 10:00
Which of the following human activities resulted in the growth of the north american deer population?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 17:40
Which organelle stores most of a cellโ€™s dna?
Answers: 2
You know the right answer?
Question:

How do transgenic animals contribute to human welfare? Include one agricultura...
Questions
question
English, 16.07.2020 04:01
Questions on the website: 13722362