The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Answers: 1
Biology, 21.06.2019 23:00
Adoctor is trying to diagnose a patient with dry skin. which of the following resources would be the most ? a magazine ad about soft skin a growth chart online articles about dry skin medical books
Answers: 2
Biology, 22.06.2019 07:00
The distant ancestors of tigers may have had bodies without stripes. use the theory of natural selection to explain how tigers may have evolved to have stripes.
Answers: 1
Biology, 22.06.2019 09:30
Astore manager timed janette to see how long it would take her to fold and put away a sweater, a shirt, a pair of pants, and a scarf. it took her 26.1 seconds for the shirt, 24.3 seconds for the sweater, 32.8 seconds for the pants, and 18.2 seconds for the scarf. what was the average time it took janette to fold and put away all four items? during a catered lunch, an average of 4 cups of tea are poured per minute. the lunch will last 2 hours. how many gallons of tea should the caterer bring if there are 16 cups in one gallon?
Answers: 1
Biology, 22.06.2019 09:30
Along what geographical feature are most of the oil producing regions located
Answers: 1
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCG...
Mathematics, 02.04.2020 15:39
English, 02.04.2020 15:39
Physics, 02.04.2020 15:39
Mathematics, 02.04.2020 15:39
Mathematics, 02.04.2020 15:39
Mathematics, 02.04.2020 15:39