What happens to matter that is used up during photosynthesis?
A)It retains its form and mass.<...
Biology, 07.04.2020 01:20 cxttiemsp021
What happens to matter that is used up during photosynthesis?
A)It retains its form and mass.
B)It retains its form but increases in mass.
C)It changes to a new form of matter with less mass.
D)It changes to a new form of matter with the same mass.
Answers: 3
Biology, 22.06.2019 03:30
Cold case files recently began re-investigating an old murder case. the murder took place in the park; a young man, james, was hit over the head with a brick and killed. police suspected the jealous former boyfriend of james' wife, karen. whoever killed james may have washed their hands in a near-by bird bath as detectives found blood in the bird bath. since the murder took place before dna fingerprinting was available, the suspected killer, ronnie, went free. detectives are now reviewing the blood evidence using dna fingerprinting. based on the dna fingerprints of all possible suspects, who is james' killer?
Answers: 2
Biology, 22.06.2019 07:30
What is one way intensive agriculture can contribute to climate change? a. tree loss to agriculture increases earth's albedo b. livestock manure absorbs greenhouse gases c. large herds of livestock release greenhouse gases d. fewer trees are available to replenish petroleum stores appex
Answers: 2
Biology, 22.06.2019 11:20
Which of the following is a limitation of a clinical trial? a.)amount of random assignments b.)hospital cost c.)number of test tubes d.)amount of peer review
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 02.03.2021 21:10
Mathematics, 02.03.2021 21:10
Mathematics, 02.03.2021 21:10
Chemistry, 02.03.2021 21:10
Mathematics, 02.03.2021 21:10
Mathematics, 02.03.2021 21:10
Computers and Technology, 02.03.2021 21:10
Chemistry, 02.03.2021 21:10
Mathematics, 02.03.2021 21:10