Biology, 09.04.2020 23:13 MikeWrice3615

What are the 4 major adaptations that plants needed to evolve in order to live on land instead of in water? Mark all that apply
growing upright

transporting resources

retaining moisture

growing roots

absorbing carbon dioxide

producing sugars

reproducing in water

reproducing on land

making flowers

Answers: 1

Show answers

Another question on Biology

Biology, 22.06.2019 06:00

Guinea pig coat color is determined by a single gene. the allele for black coat color is dominant to brown. in a cross between twoblack-haired guinea pigs, 20 offspring are born. if both parents were heterozygous, probability would predict that approximately howmany of the 20 offspring would have brown hair?

Answers: 1

Answer

Biology, 22.06.2019 06:00

Which part of the neuron below is indicated by the arrow, and what is its function? hormones send chemical signals throughout the body to regulate other body processes. hormones are chemical signals that are sent throughout the body to regulate other body processes. hormones send electrical signals throughout the body to regulate other body processes. hormones are electrical signals that are sent throughout the body to regulate other body processes.

Answers: 2

Answer

Biology, 22.06.2019 09:00

Apuppy’s tendency to chew is inherited through which of the following? a. through learned behavior b.through genes c. through seasonal cycles d. through hibernation

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

What are the 4 major adaptations that plants needed to evolve in order to live on land instead of in...

Questions