Identify the choice that best completes the statement or answers the question. Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?a. Calculate the frequencies of each letter.
b. Count the number of letters in the list.
c. Separate the list into three-letter "words."
d. Separate the list into two-, three- and four-letter "words."