![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00
The is an estimate of the fewest number of organisms a population needs to avoid extinction. this measurement will most if the number of offspring each female in the population produces increases. if the population's this measurement will most likely increase. 1 population density, minimum viable population, carrying capacity 2 decrease, be unaffected, increase 3 death rate increase, dead rate decrease
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 16:00
Abird flies by moving its wings up and down. which two systems are most directly responsible for the movement of a bird's wings? a. skeletal and muscular systems b. respiratory and muscular systems c. skeletal and digestive systems d. respiratory and digestive systems
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 18:20
During the final stage of the cell cycle, cytokinesis allows the cell to finish dividing, creating with copies of dna. can someone fill in the blanks?
Answers: 1
You know the right answer?
Which part of a persons diet plays the largest role in regulating body tempature...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 27.04.2021 21:20
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.04.2021 21:20
![question](/tpl/images/cats/mat.png)
Mathematics, 27.04.2021 21:20
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.04.2021 21:20
![question](/tpl/images/cats/mat.png)
Mathematics, 27.04.2021 21:20
![question](/tpl/images/cats/mat.png)
Mathematics, 27.04.2021 21:20
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 27.04.2021 21:20
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.04.2021 21:20
![question](/tpl/images/cats/mat.png)
Mathematics, 27.04.2021 21:20
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 27.04.2021 21:20
![question](/tpl/images/cats/mat.png)