The middle of an mRNA molecule contains the nucleotide
sequence shown here. Much more of the mRNA is translated.
Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
Construct an Explanation Based only on the information provided, why could the mRNA
section be translated into three different sets of amino acids, instead of just one set?

osteogenesis imperfecta (oi) refers to a congenital ailment of bones. in the condition, the bones become brittle or fragile. this ailment is a general result of the defect or mutations in the genes (colia1 or colia2). this mutation results in imperfect collagen formation either in quantity or quality wise.  

there are eight kinds of oi defects, and each kind varies with certain distinctions in symptoms. the usual symptoms include frequent bone fractures, loss of hearing in infants, protruding eyes, discoloration of the white in the eyes, respiratory issues, loosening of the joints, short stature, and other symptoms.  

what about it?

is this a ?